The central problem of ancient evolution of life on earth has been solved as a simple puzzle.
Evolution of transfer RNA (tRNA) can be solved in this way unambiguously.
The solution is complete and published.
tRNA is the central molecule in evolution of biological coding.
Once tRNA is evolved, cellular life becomes inevitable.
Therefore, tRNA is the most important molecule for understanding ancient evolution (from ~4 billion years ago).
tRNA is made up of these sequences:
GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC (the D loop minihelix)
~GCGGCGGCCGGGUUCAAAACCCGGCCGCCGC (the anticodon loop minihelix stem-loop-stem)
and
~GCGGCGGCCGGGUUCAAAACCCGGCCGCCGC (the T loop minihelix stem-loop-stem)
Hint: the anticodon loop minihelix and the T loop minihelix stem-loop-stems are initially identical. There is only slight ambiguity in the sequence within the loop. There is no ambiguity in the stems or the acceptor stems.
So what’s an acceptor stem?
A 5′-acceptor stem is:
GCGGCGG (a 7 nucleotide GCG repeat)
A 3′-acceptor stem is:
CCGCCGC (a 7 nucleotide CGC repeat)
These are the bolded sequences in the minihelix sequences above.
So ligate these three sequences together and get:
GCGGCGGUAGCCUAGCCUAGCCUA/CCGCCGCGC/GGCGGCCGGGUUCAAAACCCGGCCGCC/GCGCGGCGG/CCGGGUUCAAAACCCGGCCGCCGC
Delete the italic bits (between the /‘s) and you get type I tRNAs.
Delete only the leftmost italic bit and you get type II tRNAs.
Ancient evolution of life on earth reduces to this puzzle solution. All else is commentary.
Without tRNA, there is no life on earth.
Once tRNA evolves, cellular life becomes inevitable.
To evolve life on Mars or a distant planet would require evolution of a molecule very similar (or identical) to tRNA.
I should win a Nobel Prize or two for this.
Here’s the puzzle solution in color:
Evolution of type I tRNA. Start with the 93 nucleotide tRNA precursor. Make two internal deletions, as shown.
Evolving the 93 nucleotide precursor. Ligate D loop, Ac loop and T loop minihelices together. In the ancient world, these ligations are necessary to replicate minihelices.
Evolving type II tRNA. Start with the 93 nucleotide tRNA precursor. Make a single internal deletion, as shown.
tRNA evolution is a simple lesson for high school and college students. This is the most central lesson in ancient evolution of life on earth.
If you understand evolution of tRNA, you have a much richer understanding of evolution of life on earth.
Intellectual property in the minihelix world:
The D loop, Ac loop and T loop minihelices may have functioned in a primitive translation-like process before evolution of tRNA. For instance, minihelices could have been used to synthesize polyglycine to stabilize protocells.
If the Ac and T loop minihelices lacked a 7 nucleotide loop that includes a U-turn between loop positions 2 and 3, tRNA could not form an adequate adapter for translation. For instance, a 6 nucleotide or 8 nucleotide loop could not work.